|
Bio-Serv
m13 forward primer M13 Forward Primer, supplied by Bio-Serv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m13 forward primer/product/Bio-Serv Average 90 stars, based on 1 article reviews
m13 forward primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Qiagen
pdrive-specific primers m13 forward (-20) Pdrive Specific Primers M13 Forward ( 20), supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pdrive-specific primers m13 forward (-20)/product/Qiagen Average 90 stars, based on 1 article reviews
pdrive-specific primers m13 forward (-20) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Macrogen
m13 sequencing primer M13 Sequencing Primer, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m13 sequencing primer/product/Macrogen Average 90 stars, based on 1 article reviews
m13 sequencing primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Nisshinbo Chemical Inc
ird41 infrared dye labeled m13 forward primer Ird41 Infrared Dye Labeled M13 Forward Primer, supplied by Nisshinbo Chemical Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ird41 infrared dye labeled m13 forward primer/product/Nisshinbo Chemical Inc Average 90 stars, based on 1 article reviews
ird41 infrared dye labeled m13 forward primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Schuelke
m13-tailed (5′-tgtaaaacgacggccagt-3′) forward primer M13 Tailed (5′ Tgtaaaacgacggccagt 3′) Forward Primer, supplied by Schuelke, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m13-tailed (5′-tgtaaaacgacggccagt-3′) forward primer/product/Schuelke Average 90 stars, based on 1 article reviews
m13-tailed (5′-tgtaaaacgacggccagt-3′) forward primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Eurofins
primer forward + m13 ![]() Primer Forward + M13, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer forward + m13/product/Eurofins Average 90 stars, based on 1 article reviews
primer forward + m13 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Promega
m13 universal sequencing primers ![]() M13 Universal Sequencing Primers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m13 universal sequencing primers/product/Promega Average 90 stars, based on 1 article reviews
m13 universal sequencing primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Elim Bio
m13 reverse primer (5’-ggaaacagctatgaccatg-3 ![]() M13 Reverse Primer (5’ Ggaaacagctatgaccatg 3, supplied by Elim Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m13 reverse primer (5’-ggaaacagctatgaccatg-3/product/Elim Bio Average 90 stars, based on 1 article reviews
m13 reverse primer (5’-ggaaacagctatgaccatg-3 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Agencourt Bioscience Corporation
m13 forward primer ![]() M13 Forward Primer, supplied by Agencourt Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m13 forward primer/product/Agencourt Bioscience Corporation Average 90 stars, based on 1 article reviews
m13 forward primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Midland Certified Reagent
m13 forward primers complementary to the known pbluescript® sequence, located next to the genomic dna insert, ![]() M13 Forward Primers Complementary To The Known Pbluescript® Sequence, Located Next To The Genomic Dna Insert,, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m13 forward primers complementary to the known pbluescript® sequence, located next to the genomic dna insert,/product/Midland Certified Reagent Average 90 stars, based on 1 article reviews
m13 forward primers complementary to the known pbluescript® sequence, located next to the genomic dna insert, - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
SibEnzyme ltd
forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30) ![]() Forward And Reverse M13 Primers (F: 50 Gttttcccagtcacgacgttg 30 And R: 50 Tg Agcggataacaatttcacacag 30), supplied by SibEnzyme ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30)/product/SibEnzyme ltd Average 90 stars, based on 1 article reviews
forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Lucigen Corp
m13 forward and reverse primers ![]() M13 Forward And Reverse Primers, supplied by Lucigen Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m13 forward and reverse primers/product/Lucigen Corp Average 90 stars, based on 1 article reviews
m13 forward and reverse primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Advanced Biomedical Research
Article Title: BAT25, ACVR2, and TGFBR2 Mononucleotide STR Markers: A Triplex Panel for Microsatellite Instability Testing in Colorectal Tumors
doi: 10.4103/abr.abr_205_21
Figure Lengend Snippet: The information of primers for PCR of ACVR2, TGFBR2, and BAT25 mononucleotide markers
Article Snippet: 2 ,
Techniques:
Journal: Advanced Biomedical Research
Article Title: BAT25, ACVR2, and TGFBR2 Mononucleotide STR Markers: A Triplex Panel for Microsatellite Instability Testing in Colorectal Tumors
doi: 10.4103/abr.abr_205_21
Figure Lengend Snippet: PCR reagents for BAT25, ACVR2, and TGFBR2 markers
Article Snippet: 2 ,
Techniques: Concentration Assay