90
|
Bio-Serv
m13 forward primer M13 Forward Primer, supplied by Bio-Serv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+primer/pmc03565871-65-8-11?v=Bio-Serv Average 90 stars, based on 1 article reviews
m13 forward primer - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Promega
m13 universal sequencing primers M13 Universal Sequencing Primers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+primer/pm12452967-73-9-13?v=Promega Average 90 stars, based on 1 article reviews
m13 universal sequencing primers - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
SibEnzyme ltd
forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30) Forward And Reverse M13 Primers (F: 50 Gttttcccagtcacgacgttg 30 And R: 50 Tg Agcggataacaatttcacacag 30), supplied by SibEnzyme ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+primer/pm21476042-76-15-34?v=SibEnzyme+ltd Average 90 stars, based on 1 article reviews
forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Midland Certified Reagent
m13 forward primers M13 Forward Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+primer/us08513002-490-0-20?v=Midland+Certified+Reagent Average 90 stars, based on 1 article reviews
m13 forward primers - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Midland Certified Reagent
m13 forward primers complementary to the known pbluescript® sequence, located next to the genomic dna insert, M13 Forward Primers Complementary To The Known Pbluescript® Sequence, Located Next To The Genomic Dna Insert,, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+primer/us06972173-372-14-19?v=Midland+Certified+Reagent Average 90 stars, based on 1 article reviews
m13 forward primers complementary to the known pbluescript® sequence, located next to the genomic dna insert, - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Promega
forward m13-f primer Forward M13 F Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+primer/pmc04429320-52-27-37?v=Promega Average 90 stars, based on 1 article reviews
forward m13-f primer - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Commonwealth Biotechnologies Inc
m13 forward primers M13 Forward Primers, supplied by Commonwealth Biotechnologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+primer/pm10844655-282-12-21?v=Commonwealth+Biotechnologies+Inc Average 90 stars, based on 1 article reviews
m13 forward primers - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Midland Certified Reagent
m13 forward primers complementary to the known pbluescript® sequence M13 Forward Primers Complementary To The Known Pbluescript® Sequence, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+primer/us08513002-490-7-20?v=Midland+Certified+Reagent Average 90 stars, based on 1 article reviews
m13 forward primers complementary to the known pbluescript® sequence - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Ecogenics GmbH
m13-tailed forward primers M13 Tailed Forward Primers, supplied by Ecogenics GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+primer/pmc04222548-115-29-9?v=Ecogenics+GmbH Average 90 stars, based on 1 article reviews
m13-tailed forward primers - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Bioarray Inc
m13 forward (−20) 13 reverse primers M13 Forward (−20) 13 Reverse Primers, supplied by Bioarray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+primer/pm24813267-88-14-27?v=Bioarray+Inc Average 90 stars, based on 1 article reviews
m13 forward (−20) 13 reverse primers - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
GATC Biotech
m13 forward (5¢-gtaaaacgacggccag-3¢) primer M13 Forward (5¢ Gtaaaacgacggccag 3¢) Primer, supplied by GATC Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+primer/pm21435124-85-17-9?v=GATC+Biotech Average 90 stars, based on 1 article reviews
m13 forward (5¢-gtaaaacgacggccag-3¢) primer - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Midland Certified Reagent
m13-20 forward primer M13 20 Forward Primer, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13+forward+primer/pmc01594632-40-5-27?v=Midland+Certified+Reagent Average 90 stars, based on 1 article reviews
m13-20 forward primer - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |