m13 forward primer Search Results


90
Bio-Serv m13 forward primer
M13 Forward Primer, supplied by Bio-Serv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m13 forward primer/product/Bio-Serv
Average 90 stars, based on 1 article reviews
m13 forward primer - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Qiagen pdrive-specific primers m13 forward (-20)
Pdrive Specific Primers M13 Forward ( 20), supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pdrive-specific primers m13 forward (-20)/product/Qiagen
Average 90 stars, based on 1 article reviews
pdrive-specific primers m13 forward (-20) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Macrogen m13 sequencing primer
M13 Sequencing Primer, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m13 sequencing primer/product/Macrogen
Average 90 stars, based on 1 article reviews
m13 sequencing primer - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Nisshinbo Chemical Inc ird41 infrared dye labeled m13 forward primer
Ird41 Infrared Dye Labeled M13 Forward Primer, supplied by Nisshinbo Chemical Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ird41 infrared dye labeled m13 forward primer/product/Nisshinbo Chemical Inc
Average 90 stars, based on 1 article reviews
ird41 infrared dye labeled m13 forward primer - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Schuelke m13-tailed (5′-tgtaaaacgacggccagt-3′) forward primer
M13 Tailed (5′ Tgtaaaacgacggccagt 3′) Forward Primer, supplied by Schuelke, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m13-tailed (5′-tgtaaaacgacggccagt-3′) forward primer/product/Schuelke
Average 90 stars, based on 1 article reviews
m13-tailed (5′-tgtaaaacgacggccagt-3′) forward primer - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Eurofins primer forward + m13
The information of primers for PCR of ACVR2, TGFBR2, and BAT25 mononucleotide markers
Primer Forward + M13, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer forward + m13/product/Eurofins
Average 90 stars, based on 1 article reviews
primer forward + m13 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Promega m13 universal sequencing primers
The information of primers for PCR of ACVR2, TGFBR2, and BAT25 mononucleotide markers
M13 Universal Sequencing Primers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m13 universal sequencing primers/product/Promega
Average 90 stars, based on 1 article reviews
m13 universal sequencing primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Elim Bio m13 reverse primer (5’-ggaaacagctatgaccatg-3
The information of primers for PCR of ACVR2, TGFBR2, and BAT25 mononucleotide markers
M13 Reverse Primer (5’ Ggaaacagctatgaccatg 3, supplied by Elim Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m13 reverse primer (5’-ggaaacagctatgaccatg-3/product/Elim Bio
Average 90 stars, based on 1 article reviews
m13 reverse primer (5’-ggaaacagctatgaccatg-3 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Agencourt Bioscience Corporation m13 forward primer
The information of primers for PCR of ACVR2, TGFBR2, and BAT25 mononucleotide markers
M13 Forward Primer, supplied by Agencourt Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m13 forward primer/product/Agencourt Bioscience Corporation
Average 90 stars, based on 1 article reviews
m13 forward primer - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Midland Certified Reagent m13 forward primers complementary to the known pbluescript® sequence, located next to the genomic dna insert,
The information of primers for PCR of ACVR2, TGFBR2, and BAT25 mononucleotide markers
M13 Forward Primers Complementary To The Known Pbluescript® Sequence, Located Next To The Genomic Dna Insert,, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m13 forward primers complementary to the known pbluescript® sequence, located next to the genomic dna insert,/product/Midland Certified Reagent
Average 90 stars, based on 1 article reviews
m13 forward primers complementary to the known pbluescript® sequence, located next to the genomic dna insert, - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
SibEnzyme ltd forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30)
The information of primers for PCR of ACVR2, TGFBR2, and BAT25 mononucleotide markers
Forward And Reverse M13 Primers (F: 50 Gttttcccagtcacgacgttg 30 And R: 50 Tg Agcggataacaatttcacacag 30), supplied by SibEnzyme ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30)/product/SibEnzyme ltd
Average 90 stars, based on 1 article reviews
forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Lucigen Corp m13 forward and reverse primers
The information of primers for PCR of ACVR2, TGFBR2, and BAT25 mononucleotide markers
M13 Forward And Reverse Primers, supplied by Lucigen Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m13 forward and reverse primers/product/Lucigen Corp
Average 90 stars, based on 1 article reviews
m13 forward and reverse primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


The information of primers for PCR of ACVR2, TGFBR2, and BAT25 mononucleotide markers

Journal: Advanced Biomedical Research

Article Title: BAT25, ACVR2, and TGFBR2 Mononucleotide STR Markers: A Triplex Panel for Microsatellite Instability Testing in Colorectal Tumors

doi: 10.4103/abr.abr_205_21

Figure Lengend Snippet: The information of primers for PCR of ACVR2, TGFBR2, and BAT25 mononucleotide markers

Article Snippet: 2 , Primer Forward + M13 (Eurofins Company) , 10 μM , 0.2 per primer (0.15 for TGFBR2).

Techniques:

PCR reagents for BAT25, ACVR2, and TGFBR2 markers

Journal: Advanced Biomedical Research

Article Title: BAT25, ACVR2, and TGFBR2 Mononucleotide STR Markers: A Triplex Panel for Microsatellite Instability Testing in Colorectal Tumors

doi: 10.4103/abr.abr_205_21

Figure Lengend Snippet: PCR reagents for BAT25, ACVR2, and TGFBR2 markers

Article Snippet: 2 , Primer Forward + M13 (Eurofins Company) , 10 μM , 0.2 per primer (0.15 for TGFBR2).

Techniques: Concentration Assay